EENdb - TALEN/ZFN  >  ZFN detail
User comments


ZN0208
IDZN0208
Type / formZFN, dimer. (Z-D)
More about ZFN forms
Target Full sitenGTCATCTTTTACATCatggtgGATGATATCTCCAGGATGCCn
nCAGTAGAAAATGTAGtaccacCTACTATAGAGGTCCTACGGn
LengthLeft+[Spacer]+Right: 5F+[6]+(2+6F)
Speicespig (Sus scrofa)
List EENs targeting genome of pig
Gene / LocusGGTA1 G
Location to geneexon
ZFNs Left ZFP(s)ZPU0061 (F1->Fn): (N/A) (N/A) (N/A) (N/A) (N/A)
Target (5'->3'): GATGTAAAAGATGAC
Right ZFP(s)ZPU0062 (F1->Fn): (N/A) (N/A) (N/A) (N/A) (N/A) (N/A)
Target (5'->3'): GATGATATCTCCAGGATGCC
ZFN framework &
ZFP-FokI linker peptide
Framework: (N/A)
Linker peptide: (N/A)

More about ZFN frameworks & linker peptides
FokI variant(N/A)
More about FokI variants
Construction strategySangamo
List EENs constructed by Sangamo   More about ZFP construction strategies
Effectiveness
(first reported)
Genome modification
method
NHEJ
More about modification methods
Efficiency6.48%, mismatch-detection nuclease assay, in liver-derived cells (LDC).
More about efficiency detection methods
Heritability
Specificity
Comments
Reference (first reported)Li et al., J Surg Res., 2012 (22795273 R)




User comments   ^ Top

Add a new comment
NOTE:
According to legal, governmental and/or server supplier's requirements, and in order to prevent spams, your comment might need to be reviewed by the administrator before public. Please be patient and do not submit the same content again, thank you very much. Old and archived comments might be deleted.
You can also send your comments of ZN0208 to the administrator of EENdb
by e-mail.
For suggestion or comments to the whole database, please also contact us by e-mail.
Your nickname (1-16 characters, required):
Your email (1-50 characters, required): Hide email to other users
The e-mail will be shown with modifies to avoid spams for you.
Your comments (1-1500 characters, plain text only):


©2012-2013  PKU Zebrafish Functional Genomics Group
School of Life Sciences, Peking University, Beijing, China
Reference of EENdb    Contact us